معیار تشخیصی و تکرارپذیری

دانلود پایان نامه

در این مرحله دمای مخلوط واکنش به 50 تا 60 درجه سانتی گراد رسانده می شود. اگر چه این عمل سبب اتصال دوباره برخی از تک رشته های DNA هدف به یکدیگر و تشکیل مارپیچ دوگانه می گردد ولی این امکان را فراهم می کند تا آغازگرها به محل اتصال خود بچسبند.
دمای تکثیر (Extention) :
دمای مناسب در این مرحله معمولاً همان دمای بهینه برای فعالیت Taq پلیمراز؛ یا همان °C72 است. فاکتور تعیین کننده در موفقیت این مرحله انتخاب زمان است که با توجه به طول جایگاه مورد نظر از 1 تا 2 دقیقه متغیر خواهد بود.
همانطور که قبلاً ذکر شد 25 الی30 بار تکرار چرخشی این سه مرحله در نهایت موجب دستیابی به میلیون ها کپی از جایگاه مد نظر می گردد که می تواند در ارزیابی ها و واکنش های ملکولی تکمیلی بعدی مورد استفاده قرار گیرد (23).
2-6- روش تکثیر متزلزل جهش ها(ARMS-PCR) :
روش ARMS -PCR اولین بار توسط Newton و همکاران در سال 1989 بعنوان یک تکنیک عمومی جهت تشخیص جهش نقطه ای معرفی گردید.
روش ARMS استاندارد که قابلیت تشخیص چندشکلی های تک نوکلئوتیدی شناخته شده را دارد، شامل دو واکنش PCR همزمان می باشد: یک واکنش شامل آغازگر اختصاصی برای توالی DNA نرمال که نمی تواند DNA موتانت را تکثیر نماید و واکنش دیگر که حاوی آغازگر اختصاصی مکمل توالی مربوط به آلل موتانت است و قادر به تکثیر DNA طبیعی نمی باشد. ژنوتیپ افراد با آنالیز محصولات تکثیر شده قابل تعیین می باشد. برای فرد هموزیگوت تکثیر تنها در یکی از واکنش ها صورت می گیرد و برای ژنوتیپ هتروزیگوت محصولات PCR در هر دو واکنش بدست می آیند. بنابراین می توان گفت در این روش تولید یا عدم تولید محصول PCR بعنوان معیار تشخیصی جهت بررسی حضور یا عدم حضور آلل مورد نظر استفاده می شود (شکل2-2) (34).

مطلب مرتبط :   دانلود پایان نامه سیستمهای چند عامله و مدل سلسله مراتبی

شکل(2-2): روش ARMS-PCRدارای سه پرایمر نرمال، موتانت و مشترک (34)
روش ARMS دارای چندین مزیت نسبت به سایر روش های تشخیصی مبتنی بر PCR مانند PCR-RFLP می باشد. این روش سریع، قابل اعتماد، ارزان و با قابلیت تکرارپذیری بالا می باشد و با یک روز کار امکان دستیابی به نتیجه وجود دارد (34). در این بررسی طراحى پرایمرها به کمک نرم افزار Gene Runner انجام شد. مشخصات این پرایمرها در جدول (2-3) آورده شده است.
جدول (2-3): توالی آغازگرهای به کار رفته در روش ARMS-PCR
GC % طول آغازگرها توالی آغازگرها ´3´→ ۵ نام جایگاه ردیف
8/46%
bp 342 F:GCACTGGGAGCATTGAGGATT
R: GCACTGGGAGCATTGAGGATC
C:TCTAGAAACAGTTGCCTGGCAG G20210A
(Prothrombin) 1
6/34% bp 205 F:AGTTGTATGACAAGTAAATGAGT
R: AGTTGTATGACAAGTAAATGAGC
C:GAAGCTCCAAGAAACCATC -455G/A
(FGB) 2

جستجو در سایت ما :


4/58%